Objective:Recent studies revealed that serum Golgi protein 73（GP73） is a novel and promising biomarker for detection of HCC（hepatocellular carcinoma） and its sensitivity and specificity in serum are superior to a-...
详细信息
Objective:Recent studies revealed that serum Golgi protein 73（GP73） is a novel and promising biomarker for detection of HCC（hepatocellular carcinoma） and its sensitivity and specificity in serum are superior to a-fetoprotein（AFP）.So,the aim of this research is to prepare the pure anti-GP73 monoclonal antibody（mAb） with high sensitivity and specificity for detecting the serum GP73 of human,and to explore the preliminary application in early diagnosis of liver ***:The GP73-short gene was amplified,sequenced,and subcloned intopCold Ⅱ protein expression vector digested by Nde I and Hind Ⅲ.After therecombinant plasmid pCold Ⅱ-GP73-Short were constructed and transformed *** BL21（DE3）with standard procedures,the fusion GP73 protein was obtained by prokaryotic recombinant expression system and purified by immobilized metal affinity ***/c mice were immunized with purified GP73 fusion protein and the hybridoma cell lines excreting mAbs against GP73 was obtained by fusing mouse Sp2/0 myeloma cells with spleen cells from the immunized *** hybridoma cells were injected into the abdomen of Balb/c mice and ascites of Balb/c mice were purified by affinity chromatography to obtain pure mAbs against *** subtypes of anti-GP73 mAbs were determined by isotyping（IgG1,IgG2 a,IgG2b,IgG3,IgM,IgA） Kit,the binding specificity of anti-GP73 mAbs was characterized by ELISA,Western blot and immunohistochemical analysis after *** establish a newly designed double antibodysandwich ELISA（enzyme-linked immunoassay）,the experimental conditions was optimized and the standard curves were *** the levels of serum GP73 in HCC group（n=64） and health group（n=60） were tested ***:According to the sequence in GenBank,the GP73-short sequences were as follows:PI,5' GGACTTCCAGAAAGGTGTTCGC3' with the Nde Ⅰ（CATATG） restriction site;and P2,5'CTAACGCGGGGTCATAGCAACCGTC 3' with the Hind Ⅲ（AAGCTT）,which have sites for Nde Ⅰ（CATATG） and Hi
暂无评论